From 437a9c80fd12ae3e6bc49d1bdc17c0a31d5ad5e1 Mon Sep 17 00:00:00 2001 From: Aaron <aaronquinlan@gmail.com> Date: Tue, 7 Feb 2012 19:34:14 -0500 Subject: [PATCH] choose null for mapBed --- src/intersectBed/intersectBed.cpp | 2 +- src/mapBed/mapBed.cpp | 7 +- src/mapBed/mapBed.h | 3 +- src/mapBed/mapMain.cpp | 5 +- test/bamtobed/one_block.sam | 3 + test/bamtobed/test-bamtobed.sh | 113 +++++++++++++++++ test/bamtobed/three_blocks.sam | 3 + test/bamtobed/two_blocks.sam | 3 + test/bed12tobed6/bed6.bed | 1 + test/bed12tobed6/one_blocks.bed | 1 + test/bed12tobed6/test-bed12tobed6.sh | 71 +++++++++++ test/bed12tobed6/three_blocks.bed | 1 + test/bed12tobed6/two_blocks.bed | 1 + test/genomecov/one_block.sam | 3 + test/genomecov/sam-w-del.sam | 3 + test/genomecov/test-genomecov.sh | 147 ++++++++++++++++++++++ test/genomecov/three_blocks.sam | 3 + test/genomecov/three_blocks_match.bed | 1 + test/genomecov/three_blocks_match_1bp.bed | 1 + test/genomecov/three_blocks_nomatch.bed | 1 + test/genomecov/two_blocks.sam | 3 + test/intersect/one_block.sam | 3 + test/intersect/test-intersect.sh | 62 +++++++++ test/intersect/three_blocks.sam | 3 + test/intersect/three_blocks_match.bed | 1 + test/intersect/three_blocks_match_1bp.bed | 1 + test/intersect/three_blocks_nomatch.bed | 1 + test/intersect/two_blocks.sam | 3 + test/test.sh | 14 +++ 29 files changed, 459 insertions(+), 5 deletions(-) create mode 100644 test/bamtobed/one_block.sam create mode 100644 test/bamtobed/test-bamtobed.sh create mode 100644 test/bamtobed/three_blocks.sam create mode 100644 test/bamtobed/two_blocks.sam create mode 100644 test/bed12tobed6/bed6.bed create mode 100644 test/bed12tobed6/one_blocks.bed create mode 100644 test/bed12tobed6/test-bed12tobed6.sh create mode 100644 test/bed12tobed6/three_blocks.bed create mode 100644 test/bed12tobed6/two_blocks.bed create mode 100644 test/genomecov/one_block.sam create mode 100644 test/genomecov/sam-w-del.sam create mode 100644 test/genomecov/test-genomecov.sh create mode 100644 test/genomecov/three_blocks.sam create mode 100644 test/genomecov/three_blocks_match.bed create mode 100644 test/genomecov/three_blocks_match_1bp.bed create mode 100644 test/genomecov/three_blocks_nomatch.bed create mode 100644 test/genomecov/two_blocks.sam create mode 100644 test/intersect/one_block.sam create mode 100644 test/intersect/three_blocks.sam create mode 100644 test/intersect/three_blocks_match.bed create mode 100644 test/intersect/three_blocks_match_1bp.bed create mode 100644 test/intersect/three_blocks_nomatch.bed create mode 100644 test/intersect/two_blocks.sam diff --git a/src/intersectBed/intersectBed.cpp b/src/intersectBed/intersectBed.cpp index 1d410ae1..229300bc 100644 --- a/src/intersectBed/intersectBed.cpp +++ b/src/intersectBed/intersectBed.cpp @@ -328,7 +328,7 @@ void BedIntersect::IntersectBam(string bamFile) { BED bed; MakeBedFromBam(bam, chrom, bed_blocks, bed); bool overlapsFound = false; - if ((_bamOutput == true) && (_obeySplits == false)) + if ((_bamOutput == true) && (_obeySplits == false)) { overlapsFound = _bedB->anyHits(bed.chrom, bed.start, bed.end, bed.strand, _sameStrand, _diffStrand, diff --git a/src/mapBed/mapBed.cpp b/src/mapBed/mapBed.cpp index d8051103..6c5b2be5 100644 --- a/src/mapBed/mapBed.cpp +++ b/src/mapBed/mapBed.cpp @@ -19,7 +19,8 @@ double GetUserColumn(const string s); BedMap::BedMap(string bedAFile, string bedBFile, int column, string operation, float overlapFraction, bool sameStrand, bool diffStrand, bool reciprocal, - string nullValue, bool printHeader) + bool choseNullValue, string nullValue, + bool printHeader) { _bedAFile = bedAFile; @@ -33,6 +34,8 @@ BedMap::BedMap(string bedAFile, string bedBFile, int column, string operation, _nullValue = nullValue; _printHeader = printHeader; + if (!choseNullValue && operation == "count") + _nullValue = "0"; Map(); } @@ -84,7 +87,7 @@ string BedMap::MapHits(const BED &a, const vector<BED> &hits) { output << vo.GetMode(); else if (_operation == "antimode") output << vo.GetAntiMode(); - else if (_operation == "count") + else if (_operation == "count") output << setprecision (PRECISION) << vo.GetCount(); else if (_operation == "count_distinct") output << setprecision (PRECISION) << vo.GetCountDistinct(); diff --git a/src/mapBed/mapBed.h b/src/mapBed/mapBed.h index 91dfa107..f8cc5de1 100644 --- a/src/mapBed/mapBed.h +++ b/src/mapBed/mapBed.h @@ -41,7 +41,8 @@ public: BedMap(string bedAFile, string bedBFile, int column, string operation, float overlapFraction, bool sameStrand, bool diffStrand, bool reciprocal, - string nullValue, bool printHeader); + bool choseNullValue, string nullValue, + bool printHeader); // destructor ~BedMap(void); diff --git a/src/mapBed/mapMain.cpp b/src/mapBed/mapMain.cpp index 1ecf6869..8f1559d5 100644 --- a/src/mapBed/mapMain.cpp +++ b/src/mapBed/mapMain.cpp @@ -48,6 +48,7 @@ int map_main(int argc, char* argv[]) { bool sameStrand = false; bool diffStrand = false; bool printHeader = false; + bool choseNullValue = false; // check to see if we should print out some help if(argc <= 1) showHelp = true; @@ -114,6 +115,7 @@ int map_main(int argc, char* argv[]) { } else if (PARAMETER_CHECK("-null", 5, parameterLength)) { nullValue = argv[i + 1]; + choseNullValue = true; i++; } else if(PARAMETER_CHECK("-header", 7, parameterLength)) { @@ -146,7 +148,8 @@ int map_main(int argc, char* argv[]) { BedMap *bm = new BedMap(bedAFile, bedBFile, column, operation, overlapFraction, sameStrand, diffStrand, reciprocalFraction, - nullValue, printHeader); + choseNullValue, nullValue, + printHeader); delete bm; return 0; } diff --git a/test/bamtobed/one_block.sam b/test/bamtobed/one_block.sam new file mode 100644 index 00000000..83041cf5 --- /dev/null +++ b/test/bamtobed/one_block.sam @@ -0,0 +1,3 @@ +@HD VN:1.0 GO:none SO:coordinate +@SQ SN:chr1 LN:249250621 +one_blocks 16 chr1 1 40 30M * 0 0 GAAGGCCACCGCCGCGGTTATTTTCCTTCA CCCDDB?=FJIIJIGFJIJHIJJJJJJJJI MD:Z:50 diff --git a/test/bamtobed/test-bamtobed.sh b/test/bamtobed/test-bamtobed.sh new file mode 100644 index 00000000..0d028e74 --- /dev/null +++ b/test/bamtobed/test-bamtobed.sh @@ -0,0 +1,113 @@ +BT=../../bin/bedtools + +check() +{ + if diff $1 $2; then + echo ok + else + echo fail + fi +} + +########################################################### +########################################################### +# BAM files # +########################################################### +########################################################### +samtools view -Sb one_block.sam > one_block.bam 2>/dev/null +samtools view -Sb two_blocks.sam > two_blocks.bam 2>/dev/null +samtools view -Sb three_blocks.sam > three_blocks.bam 2>/dev/null +samtools view -Sb sam-w-del.sam > sam-w-del.bam 2>/dev/null + + +################################################################## +# Test one block without -split +################################################################## +echo " bamtobed.t1...\c" +echo \ +"chr1 0 30 one_blocks 40 -" > exp +$BT bamtobed -i one_block.bam > obs +check obs exp +rm obs exp + + +################################################################## +# Test one block with -split +################################################################## +echo " bamtobed.t2...\c" +echo \ +"chr1 0 30 one_blocks 40 -" > exp +$BT bamtobed -i one_block.bam -split > obs +check obs exp +rm obs exp + + +################################################################## +# Test two blocks without -split +################################################################## +echo " bamtobed.t3...\c" +echo \ +"chr1 0 40 two_blocks 40 -" > exp +$BT bamtobed -i two_blocks.bam > obs +check obs exp +rm obs exp + + +################################################################## +# Test two blocks with -split +################################################################## +echo " bamtobed.t4...\c" +echo \ +"chr1 0 15 two_blocks 40 - +chr1 25 40 two_blocks 40 -" > exp +$BT bamtobed -i two_blocks.bam -split > obs +check obs exp +rm obs exp + + +################################################################## +# Test three blocks without -split +################################################################## +echo " bamtobed.t5...\c" +echo \ +"chr1 0 50 three_blocks 40 -" > exp +$BT bamtobed -i three_blocks.bam > obs +check obs exp +rm obs exp + + +################################################################## +# Test three blocks with -split +################################################################## +echo " bamtobed.t6...\c" +echo \ +"chr1 0 10 three_blocks 40 - +chr1 20 30 three_blocks 40 - +chr1 40 50 three_blocks 40 -" > exp +$BT bamtobed -i three_blocks.bam -split > obs +check obs exp +rm obs exp + + +################################################################## +# Test three blocks with -bed12 +################################################################## +echo " bamtobed.t7...\c" +echo \ +"chr1 0 50 three_blocks 40 - 0 50 255,0,0 3 10,10,10 0,20,40" > exp +$BT bamtobed -i three_blocks.bam -bed12 > obs +check obs exp +rm obs exp + + +################################################################## +# Ensure that both ways of getting blocks from a spliced alignment +# are indenticsl +################################################################## +echo " bamtobed.t8...\c" +$BT bamtobed -i three_blocks.bam -split > split +$BT bamtobed -i three_blocks.bam -bed12 | $BT bed12tobed6 > bed12 +check split bed12 +rm split bed12 + +rm *.bam diff --git a/test/bamtobed/three_blocks.sam b/test/bamtobed/three_blocks.sam new file mode 100644 index 00000000..6e3bc601 --- /dev/null +++ b/test/bamtobed/three_blocks.sam @@ -0,0 +1,3 @@ +@HD VN:1.0 GO:none SO:coordinate +@SQ SN:chr1 LN:249250621 +three_blocks 16 chr1 1 40 10M10N10M10N10M * 0 0 GAAGGCCACCGCCGCGGTTATTTTCCTTCA CCCDDB?=FJIIJIGFJIJHIJJJJJJJJI MD:Z:50 diff --git a/test/bamtobed/two_blocks.sam b/test/bamtobed/two_blocks.sam new file mode 100644 index 00000000..6f19dcf9 --- /dev/null +++ b/test/bamtobed/two_blocks.sam @@ -0,0 +1,3 @@ +@HD VN:1.0 GO:none SO:coordinate +@SQ SN:chr1 LN:249250621 +two_blocks 16 chr1 1 40 15M10N15M * 0 0 GAAGGCCACCGCCGCGGTTATTTTCCTTCA CCCDDB?=FJIIJIGFJIJHIJJJJJJJJI MD:Z:50 \ No newline at end of file diff --git a/test/bed12tobed6/bed6.bed b/test/bed12tobed6/bed6.bed new file mode 100644 index 00000000..e3a0a985 --- /dev/null +++ b/test/bed12tobed6/bed6.bed @@ -0,0 +1 @@ +chr1 0 50 bed6 1 + \ No newline at end of file diff --git a/test/bed12tobed6/one_blocks.bed b/test/bed12tobed6/one_blocks.bed new file mode 100644 index 00000000..a2604779 --- /dev/null +++ b/test/bed12tobed6/one_blocks.bed @@ -0,0 +1 @@ +chr1 0 50 one_blocks_match 0 + 0 0 0 1 50, 0, diff --git a/test/bed12tobed6/test-bed12tobed6.sh b/test/bed12tobed6/test-bed12tobed6.sh new file mode 100644 index 00000000..1cc53e86 --- /dev/null +++ b/test/bed12tobed6/test-bed12tobed6.sh @@ -0,0 +1,71 @@ +BT=../../bin/bedtools + +check() +{ + if diff $1 $2; then + echo ok + else + echo fail + fi +} + + +################################################################## +# Test one block +################################################################## +echo " bed12tobed6.t1...\c" +echo \ +"chr1 0 50 one_blocks_match 0 +" > exp +$BT bed12tobed6 -i one_blocks.bed > obs +check obs exp +rm obs exp + + +################################################################## +# Test two blocks +################################################################## +echo " bed12tobed6.t2...\c" +echo \ +"chr1 0 10 two_blocks_match 0 + +chr1 40 50 two_blocks_match 0 +" > exp +$BT bed12tobed6 -i two_blocks.bed > obs +check obs exp +rm obs exp + +################################################################## +# Test three blocks +################################################################## +echo " bed12tobed6.t3...\c" +echo \ +"chr1 0 10 three_blocks_match 0 + +chr1 20 30 three_blocks_match 0 + +chr1 40 50 three_blocks_match 0 +" > exp +$BT bed12tobed6 -i three_blocks.bed > obs +check obs exp +rm obs exp + + +################################################################## +# Test three blocks and add block numbers +################################################################## +echo " bed12tobed6.t4...\c" +echo \ +"chr1 0 10 three_blocks_match 1 + +chr1 20 30 three_blocks_match 2 + +chr1 40 50 three_blocks_match 3 +" > exp +$BT bed12tobed6 -i three_blocks.bed -n > obs +check obs exp +rm obs exp + + +################################################################## +# Test three blocks and add block numbers. Test reverse strand +################################################################## +echo " bed12tobed6.t5...\c" +echo \ +"chr1 0 10 three_blocks_match 3 - +chr1 20 30 three_blocks_match 2 - +chr1 40 50 three_blocks_match 1 -" > exp +sed -e 's/\+/\-/' three_blocks.bed | $BT bed12tobed6 -n > obs +check obs exp +rm obs exp \ No newline at end of file diff --git a/test/bed12tobed6/three_blocks.bed b/test/bed12tobed6/three_blocks.bed new file mode 100644 index 00000000..33123c2f --- /dev/null +++ b/test/bed12tobed6/three_blocks.bed @@ -0,0 +1 @@ +chr1 0 50 three_blocks_match 0 + 0 0 0 3 10,10,10, 0,20,40, diff --git a/test/bed12tobed6/two_blocks.bed b/test/bed12tobed6/two_blocks.bed new file mode 100644 index 00000000..5fcfa6d5 --- /dev/null +++ b/test/bed12tobed6/two_blocks.bed @@ -0,0 +1 @@ +chr1 0 50 two_blocks_match 0 + 0 0 0 2 10,10, 0,40, diff --git a/test/genomecov/one_block.sam b/test/genomecov/one_block.sam new file mode 100644 index 00000000..48408220 --- /dev/null +++ b/test/genomecov/one_block.sam @@ -0,0 +1,3 @@ +@HD VN:1.0 GO:none SO:coordinate +@SQ SN:chr1 LN:1000 +one_blocks 16 chr1 1 40 30M * 0 0 GAAGGCCACCGCCGCGGTTATTTTCCTTCA CCCDDB?=FJIIJIGFJIJHIJJJJJJJJI MD:Z:50 \ No newline at end of file diff --git a/test/genomecov/sam-w-del.sam b/test/genomecov/sam-w-del.sam new file mode 100644 index 00000000..887b745d --- /dev/null +++ b/test/genomecov/sam-w-del.sam @@ -0,0 +1,3 @@ +@HD VN:1.0 GO:none SO:coordinate +@SQ SN:chr1 LN:1000 +one_bp_del 16 chr1 1 40 10M1D10M * 0 0 GAAGGCCACCGCCGCGCCGC CCCDDB?=FJIIJIGIIJIG MD:Z:50 diff --git a/test/genomecov/test-genomecov.sh b/test/genomecov/test-genomecov.sh new file mode 100644 index 00000000..b7102d5d --- /dev/null +++ b/test/genomecov/test-genomecov.sh @@ -0,0 +1,147 @@ +BT=../../bin/bedtools + +check() +{ + if diff $1 $2; then + echo ok + else + echo fail + fi +} + +########################################################### +########################################################### +# BAM files # +########################################################### +########################################################### +samtools view -Sb one_block.sam > one_block.bam 2>/dev/null +samtools view -Sb two_blocks.sam > two_blocks.bam 2>/dev/null +samtools view -Sb three_blocks.sam > three_blocks.bam 2>/dev/null +samtools view -Sb sam-w-del.sam > sam-w-del.bam 2>/dev/null + + + +################################################################## +# Test three blocks without -split +################################################################## +echo " genomecov.t1...\c" +echo \ +"chr1 0 50 1" > exp +$BT genomecov -ibam three_blocks.bam -bg > obs +check obs exp +rm obs exp + + +################################################################## +# Test three blocks with -split +################################################################## +echo " genomecov.t2...\c" +echo \ +"chr1 0 10 1 +chr1 20 30 1 +chr1 40 50 1" > exp +$BT genomecov -ibam three_blocks.bam -bg -split > obs +check obs exp +rm obs exp + + +################################################################## +# Test three blocks with -split and -bga +################################################################## +echo " genomecov.t3...\c" +echo \ +"chr1 0 10 1 +chr1 10 20 0 +chr1 20 30 1 +chr1 30 40 0 +chr1 40 50 1 +chr1 50 1000 0" > exp +$BT genomecov -ibam three_blocks.bam -bga -split > obs +check obs exp +rm obs exp + + +################################################################## +# Test blocked BAM from multiple files w/ -bga and w/o -split +################################################################## +echo " genomecov.t4...\c" +echo \ +"chr1 0 30 3 +chr1 30 40 2 +chr1 40 50 1 +chr1 50 1000 0" > exp +samtools merge -f /dev/stdout *block*.bam | $BT genomecov -ibam - -bga > obs +check obs exp +rm obs exp + + +################################################################## +# Test blocked BAM from multiple files w/ -bga and w -split +################################################################## +echo " genomecov.t5...\c" +echo \ +"chr1 0 10 3 +chr1 10 15 2 +chr1 15 20 1 +chr1 20 25 2 +chr1 25 30 3 +chr1 30 50 1 +chr1 50 1000 0" > exp +samtools merge -f /dev/stdout *block*.bam | $BT genomecov -ibam - -bga -split > obs +check obs exp +rm obs exp + + +################################################################## +# Test three blocks with -split and -dz +################################################################## +echo " genomecov.t6...\c" +echo \ +"chr1 0 1 +chr1 1 1 +chr1 2 1 +chr1 3 1 +chr1 4 1 +chr1 5 1 +chr1 6 1 +chr1 7 1 +chr1 8 1 +chr1 9 1 +chr1 20 1 +chr1 21 1 +chr1 22 1 +chr1 23 1 +chr1 24 1 +chr1 25 1 +chr1 26 1 +chr1 27 1 +chr1 28 1 +chr1 29 1 +chr1 40 1 +chr1 41 1 +chr1 42 1 +chr1 43 1 +chr1 44 1 +chr1 45 1 +chr1 46 1 +chr1 47 1 +chr1 48 1 +chr1 49 1" > exp +$BT genomecov -ibam three_blocks.bam -dz -split > obs +check obs exp +rm obs exp + + +################################################################## +# Test SAM with 1bp D operator +################################################################## +echo " genomecov.t7...\c" +echo \ +"chr1 0 10 1 +chr1 11 21 1" > exp +$BT genomecov -ibam sam-w-del.bam -bg > obs +check obs exp +rm obs exp + + +rm *.bam \ No newline at end of file diff --git a/test/genomecov/three_blocks.sam b/test/genomecov/three_blocks.sam new file mode 100644 index 00000000..9bf1a627 --- /dev/null +++ b/test/genomecov/three_blocks.sam @@ -0,0 +1,3 @@ +@HD VN:1.0 GO:none SO:coordinate +@SQ SN:chr1 LN:1000 +three_blocks 16 chr1 1 40 10M10N10M10N10M * 0 0 GAAGGCCACCGCCGCGGTTATTTTCCTTCA CCCDDB?=FJIIJIGFJIJHIJJJJJJJJI MD:Z:50 diff --git a/test/genomecov/three_blocks_match.bed b/test/genomecov/three_blocks_match.bed new file mode 100644 index 00000000..33123c2f --- /dev/null +++ b/test/genomecov/three_blocks_match.bed @@ -0,0 +1 @@ +chr1 0 50 three_blocks_match 0 + 0 0 0 3 10,10,10, 0,20,40, diff --git a/test/genomecov/three_blocks_match_1bp.bed b/test/genomecov/three_blocks_match_1bp.bed new file mode 100644 index 00000000..de8b10d2 --- /dev/null +++ b/test/genomecov/three_blocks_match_1bp.bed @@ -0,0 +1 @@ +chr1 10 60 three_blocks_nomatch 0 + 0 0 0 3 11,10,10, 0,20,40, diff --git a/test/genomecov/three_blocks_nomatch.bed b/test/genomecov/three_blocks_nomatch.bed new file mode 100644 index 00000000..1835260e --- /dev/null +++ b/test/genomecov/three_blocks_nomatch.bed @@ -0,0 +1 @@ +chr1 10 60 three_blocks_nomatch 0 + 0 0 0 3 10,10,10, 0,20,40, diff --git a/test/genomecov/two_blocks.sam b/test/genomecov/two_blocks.sam new file mode 100644 index 00000000..a28928ab --- /dev/null +++ b/test/genomecov/two_blocks.sam @@ -0,0 +1,3 @@ +@HD VN:1.0 GO:none SO:coordinate +@SQ SN:chr1 LN:1000 +two_blocks 16 chr1 1 40 15M10N15M * 0 0 GAAGGCCACCGCCGCGGTTATTTTCCTTCA CCCDDB?=FJIIJIGFJIJHIJJJJJJJJI MD:Z:50 \ No newline at end of file diff --git a/test/intersect/one_block.sam b/test/intersect/one_block.sam new file mode 100644 index 00000000..83041cf5 --- /dev/null +++ b/test/intersect/one_block.sam @@ -0,0 +1,3 @@ +@HD VN:1.0 GO:none SO:coordinate +@SQ SN:chr1 LN:249250621 +one_blocks 16 chr1 1 40 30M * 0 0 GAAGGCCACCGCCGCGGTTATTTTCCTTCA CCCDDB?=FJIIJIGFJIJHIJJJJJJJJI MD:Z:50 diff --git a/test/intersect/test-intersect.sh b/test/intersect/test-intersect.sh index bbc0cbee..ac12faa1 100644 --- a/test/intersect/test-intersect.sh +++ b/test/intersect/test-intersect.sh @@ -190,6 +190,68 @@ rm obs exp # -split # ########################################################### ########################################################### +samtools view -Sb one_block.sam > one_block.bam 2>/dev/null +samtools view -Sb two_blocks.sam > two_blocks.bam 2>/dev/null +samtools view -Sb three_blocks.sam > three_blocks.bam 2>/dev/null +################################################################## +# Test three blocks matches BED without -split +################################################################## +echo " intersect.t17...\c" +echo \ +"three_blocks 16 chr1 1 40 10M10N10M10N10M * 0 0 GAAGGCCACCGCCGCGGTTATTTTCCTTCA CCCDDB?=FJIIJIGFJIJHIJJJJJJJJI MD:Z:50" > exp +$BT intersect -abam three_blocks.bam -b three_blocks_nomatch.bed | samtools view - > obs +check obs exp +rm obs exp + +################################################################## +# Test three blocks does not match BED with -split +################################################################## +echo " intersect.t18...\c" +touch exp +$BT intersect -abam three_blocks.bam -b three_blocks_nomatch.bed -split | samtools view - > obs +check obs exp +rm obs exp + +################################################################## +# Test three blocks matches BED with -split +################################################################## +echo " intersect.t19...\c" +echo \ +"three_blocks 16 chr1 1 40 10M10N10M10N10M * 0 0 GAAGGCCACCGCCGCGGTTATTTTCCTTCA CCCDDB?=FJIIJIGFJIJHIJJJJJJJJI MD:Z:50" > exp +$BT intersect -abam three_blocks.bam -b three_blocks_match.bed -split | samtools view - > obs +check obs exp +rm obs exp + +################################################################## +# Test three blocks does not match BED with -split and -s +# BAM os -, BED is + +################################################################## +echo " intersect.t20...\c" +touch exp +$BT intersect -abam three_blocks.bam -b three_blocks_match.bed -split -s | samtools view - > obs +check obs exp +rm obs exp + +################################################################## +# Test three blocks match BED that overlap 1bp with -split +################################################################## +echo " intersect.t21...\c" +echo \ +"three_blocks 16 chr1 1 40 10M10N10M10N10M * 0 0 GAAGGCCACCGCCGCGGTTATTTTCCTTCA CCCDDB?=FJIIJIGFJIJHIJJJJJJJJI MD:Z:50" > exp +$BT intersect -abam three_blocks.bam -b three_blocks_match_1bp.bed -split | samtools view - > obs +check obs exp +rm obs exp + +################################################################################ +# Test three blocks does not match BED that overlap 1bp with -split and -f 0.1 +################################################################################ +echo " intersect.t22...\c" +touch exp +$BT intersect -abam three_blocks.bam -b three_blocks_match_1bp.bed -split -f 0.1 | samtools view - > obs +check obs exp +rm obs exp + +rm *.bam \ No newline at end of file diff --git a/test/intersect/three_blocks.sam b/test/intersect/three_blocks.sam new file mode 100644 index 00000000..6e3bc601 --- /dev/null +++ b/test/intersect/three_blocks.sam @@ -0,0 +1,3 @@ +@HD VN:1.0 GO:none SO:coordinate +@SQ SN:chr1 LN:249250621 +three_blocks 16 chr1 1 40 10M10N10M10N10M * 0 0 GAAGGCCACCGCCGCGGTTATTTTCCTTCA CCCDDB?=FJIIJIGFJIJHIJJJJJJJJI MD:Z:50 diff --git a/test/intersect/three_blocks_match.bed b/test/intersect/three_blocks_match.bed new file mode 100644 index 00000000..33123c2f --- /dev/null +++ b/test/intersect/three_blocks_match.bed @@ -0,0 +1 @@ +chr1 0 50 three_blocks_match 0 + 0 0 0 3 10,10,10, 0,20,40, diff --git a/test/intersect/three_blocks_match_1bp.bed b/test/intersect/three_blocks_match_1bp.bed new file mode 100644 index 00000000..de8b10d2 --- /dev/null +++ b/test/intersect/three_blocks_match_1bp.bed @@ -0,0 +1 @@ +chr1 10 60 three_blocks_nomatch 0 + 0 0 0 3 11,10,10, 0,20,40, diff --git a/test/intersect/three_blocks_nomatch.bed b/test/intersect/three_blocks_nomatch.bed new file mode 100644 index 00000000..1835260e --- /dev/null +++ b/test/intersect/three_blocks_nomatch.bed @@ -0,0 +1 @@ +chr1 10 60 three_blocks_nomatch 0 + 0 0 0 3 10,10,10, 0,20,40, diff --git a/test/intersect/two_blocks.sam b/test/intersect/two_blocks.sam new file mode 100644 index 00000000..6f19dcf9 --- /dev/null +++ b/test/intersect/two_blocks.sam @@ -0,0 +1,3 @@ +@HD VN:1.0 GO:none SO:coordinate +@SQ SN:chr1 LN:249250621 +two_blocks 16 chr1 1 40 15M10N15M * 0 0 GAAGGCCACCGCCGCGGTTATTTTCCTTCA CCCDDB?=FJIIJIGFJIJHIJJJJJJJJI MD:Z:50 \ No newline at end of file diff --git a/test/test.sh b/test/test.sh index da6b533b..9c287896 100644 --- a/test/test.sh +++ b/test/test.sh @@ -3,6 +3,20 @@ cd general sh test-general.sh cd .. +echo " Testing bedtools bed12tobed6:" +cd bed12tobed6 +sh test-bed12tobed6.sh +cd .. + +echo " Testing bedtools bamtobed:" +cd bamtobed +sh test-bamtobed.sh +cd .. + +echo " Testing bedtools genomecov:" +cd genomecov +sh test-genomecov.sh +cd .. echo " Testing bedtools intersect:" cd intersect -- GitLab